NOTE: We are working on migrating this site away from MediaWiki, so editing pages will be disabled for now.
Template:GFF3FASTA
From GMOD
GFF3 files can also include sequence in FASTA format at the end of the file. The FASTA sequences are preceded by a ##FASTA line. This sequence section is optional. If present, the sequence section can define sequence for any landmark used in column 1 (the frame of reference). For example: For example:
##gff-version 3 ctg123 . exon 1300 1500 . + . ID=exon00001 ctg123 . exon 1050 1500 . + . ID=exon00002 ctg123 . exon 3000 3902 . + . ID=exon00003 ctg123 . exon 5000 5500 . + . ID=exon00004 ctg123 . exon 7000 9000 . + . ID=exon00005 ##FASTA >ctg123 cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat cttaaatgtatttccgacgaattcgaggcctgaaaagtgtgacgccattc ...
When the GFF3 file is processed the IDs on the header line of FASTA entries are matched with IDs used in column 1 in the annotation section of the file.
You don't have to store the FASTA in the GFF file. You can also store your sequences in a separate file containing only FASTA entries.